Sold by: NVIDIAÂ
Deployed on AWS
Free Trial
Evo 2 is a biological foundation model that can interpret and generate DNA sequences across various biological scales: from individual molecules to entire genomes while retaining sensitivity to single-nucleotide changes, enabling zero-shot predictions and complex biological system designs.
Overview
Evo2 potential applications spans from accelerating drug discovery to advancing synthetic biology.
Evo 2 model was trained by Arc Institute. The model training involved a vast dataset of genomes, which enabled Evo 2 to perform a wide range of tasks, from predicting the impact of mutations on protein performance to generating complex molecular systems like CRISPR-Cas complexes. For example, the model demonstrated that it was able to design new versions of the CRISPR genome editor showcased its potential for creating novel biological tools.
Highlights
- Evo2 is a biological foundation model that can integrate information across long genomic sequences while retaining sensitivity to single-nucleotide changes.
- Evo2 can perform zero-shot function prediction for genes. Evo also can perform multi-element generation tasks, such as generating synthetic CRISPR-Cas molecular complexes.
- Evo 2 can also predict gene essentiality at nucleotide resolution and can generate coding-rich sequences up to at least 1M kb in length. Advances in multi-modal and multi-scale learning with Evo provide a promising path toward improving our understanding and control of biology across multiple levels of complexity.
Details
Sold by
Delivery method
Latest version
Deployed on AWS
Unlock automation with AI agent solutions
Fast-track AI initiatives with agents, tools, and solutions from AWS Partners.
Features and programs
Financing for AWS Marketplace purchases
AWS Marketplace now accepts line of credit payments through the PNC Vendor Finance program. This program is available to select AWS customers in the US, excluding NV, NC, ND, TN, & VT.
Pricing
Free trial
Try this product free for 31 days according to the free trial terms set by the vendor.
Pricing is based on actual usage, with charges varying according to how much you consume. Subscriptions have no end date and may be canceled any time.
Additional AWS infrastructure costs may apply. Use the AWS Pricing Calculator to estimate your infrastructure costs.
Dimension | Description | Cost/host/hour |
|---|---|---|
ml.g5.12xlarge Inference (Batch) Recommended | Model inference on the ml.g5.12xlarge instance type, batch mode | $1.00 |
ml.g6e.12xlarge Inference (Real-Time) Recommended | Model inference on the ml.g6e.12xlarge instance type, real-time mode | $1.00 |
ml.g6e.24xlarge Inference (Real-Time) | Model inference on the ml.g6e.24xlarge instance type, real-time mode | $1.00 |
ml.g6e.48xlarge Inference (Real-Time) | Model inference on the ml.g6e.48xlarge instance type, real-time mode | $1.00 |
ml.p4d.24xlarge Inference (Real-Time) | Model inference on the ml.p4d.24xlarge instance type, real-time mode | $1.00 |
ml.p4de.24xlarge Inference (Real-Time) | Model inference on the ml.p4de.24xlarge instance type, real-time mode | $1.00 |
ml.p5.48xlarge Inference (Real-Time) | Model inference on the ml.p5.48xlarge instance type, real-time mode | $1.00 |
ml.p5e.48xlarge Inference (Real-Time) | Model inference on the ml.p5e.48xlarge instance type, real-time mode | $1.00 |
ml.p5en.48xlarge Inference (Real-Time) | Model inference on the ml.p5en.48xlarge instance type, real-time mode | $1.00 |
Vendor refund policy
None
Legal
Vendor terms and conditions
Upon subscribing to this product, you must acknowledge and agree to the terms and conditions outlined in the vendor's End User License Agreement (EULA)Â .
Content disclaimer
Vendors are responsible for their product descriptions and other product content. AWS does not warrant that vendors' product descriptions or other product content are accurate, complete, reliable, current, or error-free.
Delivery details
Amazon SageMaker model
An Amazon SageMaker model package is a pre-trained machine learning model ready to use without additional training. Use the model package to create a model on Amazon SageMaker for real-time inference or batch processing. Amazon SageMaker is a fully managed platform for building, training, and deploying machine learning models at scale.
Deploy the model on Amazon SageMaker AI using the following options:
Version release notes
Additional details
Inputs
- Summary
The model accepts JSON requests with parameters on /invocations and /ping APIs that can be used to control the generated text. See examples and field descriptions below.
- Input MIME type
- application/json
sm_runtime = boto3.client("sagemaker-runtime", region_name=region)
generate_payload = {
"sequence": "ACGTACGTACGT",
"num_tokens": 100,
"temperature": 0.7,
"top_k": 3,
}
response = sm_runtime.invoke_endpoint(
EndpointName='Evo2-40b-2-1-0',
ContentType="application/json",
Body=json.dumps(generate_payload),
)
result = json.loads(response["Body"].read())
print("Generated DNA:", result["sequence"])
print("Elapsed (ms):", result.get("elapsed_ms"))
Custom attributes
The following table describes custom attributes for real-time inference endpoints.
Field name | Description | Constraints | Required |
|---|---|---|---|
Forward | Run the model forward pass and save the layers outputs
Endpoint path: /biology/arc/evo2/forward | forward_payload = {
"sequence": "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
"output_layers": [
"decoder.layers.0.mlp",
"decoder.layers.10.mlp.linear_fc2",
],
}
response = sm_runtime.invoke_endpoint(
EndpointName='Evo2-40b-2-1-0',
ContentType="application/json",
Body=json.dumps(forward_payload),
CustomAttributes="route=forward", # routes through Caddy to /forward
)
forward_result = json.loads(response["Body"].read())
print("Elapsed (ms):", forward_result["elapsed_ms"])
print("NPZ size (bytes):", len(forward_result["data"])) | No |
Resources
Support
Vendor support
Free support via NVIDIA NIM Developer Forum:
AWS infrastructure support
AWS Support is a one-on-one, fast-response support channel that is staffed 24x7x365 with experienced and technical support engineers. The service helps customers of all sizes and technical abilities to successfully utilize the products and features provided by Amazon Web Services.
Customer reviews
No customer reviews yet
Be the first to review this product . We've partnered with PeerSpot to gather customer feedback. You can share your experience by writing or recording a review, or scheduling a call with a PeerSpot analyst.