AWS Big Data Blog

Tag: Healthcare

Building a Real World Evidence Platform on AWS

Deriving insights from large datasets is central to nearly every industry, and life sciences is no exception. To combat the rising cost of bringing drugs to market, pharmaceutical companies are looking for ways to optimize their drug development processes. They are turning to big data analytics to better quantify the effect that their drug compounds […]

Read More

Analyze OpenFDA Data in R with Amazon S3 and Amazon Athena

One of the great benefits of Amazon S3 is the ability to host, share, or consume public data sets. This provides transparency into data to which an external data scientist or developer might not normally have access. By exposing the data to the public, you can glean many insights that would have been difficult with […]

Read More

Build a Healthcare Data Warehouse Using Amazon EMR, Amazon Redshift, AWS Lambda, and OMOP

In the healthcare field, data comes in all shapes and sizes. Despite efforts to standardize terminology, some concepts (e.g., blood glucose) are still often depicted in different ways. This post demonstrates how to convert an openly available dataset called MIMIC-III, which consists of de-identified medical data for about 40,000 patients, into an open source data […]

Read More

Create a Healthcare Data Hub with AWS and Mirth Connect

As anyone visiting their doctor may have noticed, gone are the days of physicians recording their notes on paper. Physicians are more likely to enter the exam room with a laptop than with paper and pen. This change is the byproduct of efforts to improve patient outcomes, increase efficiency, and drive population health. Pushing for […]

Read More

Interactive Analysis of Genomic Datasets Using Amazon Athena

Aaron Friedman is a Healthcare and Life Sciences Solutions Architect with Amazon Web Services The genomics industry is in the midst of a data explosion. Due to the rapid drop in the cost to sequence genomes, genomics is now central to many medical advances. When your genome is sequenced and analyzed, raw sequencing files are […]

Read More

Optimizing Amazon S3 for High Concurrency in Distributed Workloads

Aaron Friedman is a Healthcare and Life Sciences Solution Architect with Amazon Web Services The healthcare and life sciences landscape is being transformed rapidly by big data. By intersecting petabytes of genomic data with clinical information, AWS customers and partners are already changing healthcare as we know it. One of the most important things in […]

Read More

How Eliza Corporation Moved Healthcare Data to the Cloud

This is a guest post by Laxmikanth Malladi, Chief Architect at NorthBay. NorthBay is an AWS Advanced Consulting Partner and an AWS Big Data Competency Partner “Pay-for-performance” in healthcare pays providers more to keep the people under their care healthier. This is a departure from fee-for-service where payments are for each service used. Pay-for-performance arrangements provide […]

Read More

Readmission Prediction Through Patient Risk Stratification Using Amazon Machine Learning

Ujjwal Ratan is a Solutions Architect with Amazon Web Services The Hospital Readmission Reduction Program (HRRP) was included as part of the Affordable Care Act to improve quality of care and lower healthcare spending. A patient visit to a hospital may be constituted as a readmission if the patient in question is admitted to a […]

Read More

Will Spark Power the Data behind Precision Medicine?

Christopher Crosbie is a Healthcare and Life Science Solutions Architect with Amazon Web Services. This post was co-authored by Ujjwal Ratan, a Solutions Architect with Amazon Web Services. ——————————— “And that’s the promise of precision medicine — delivering the right treatments, at the right time, every time to the right person.“ (President Obama, 2015 State […]

Read More

Extending Seven Bridges Genomics with Amazon Redshift and R

Christopher Crosbie is a Healthcare and Life Science Solutions Architect with Amazon Web Services The article was co-authored by Zeynep Onder, Scientist, Seven Bridges Genomics, an AWS Advanced Technology Partner. “ACTGCTTCGACTCGGGTCCA” That is probably not a coding language readily understood by many reading this blog post, but it is a programming framework that defines all […]

Read More